for loop - C - error after for() cicle -


i've been coding in c solve problem in rosalind's website. code simple, , because it's simple, it's hard correct error.(i guess) here code:

    /* string ordered collection of symbols selected alphabet , formed word; length of string number of symbols contains.  example of length 21 dna string (whose alphabet contains symbols 'a', 'c', 'g', , 't') "atgcttcagaaaggtcttacg."  given: dna string s of length @ 1000 nt.  return: 4 integers (separated spaces) counting respective number of times symbols 'a', 'c', 'g', , 't' occur in s. */  #include <stdio.h>  int main(){     char nt;     int na, nc, ng, nt;     for(int = 0, na = nc = ng = nt = 0; < 1000; i++){         nt = getchar();         if(nt == 'a'){             na++;         }else if(nt == 'c'){             nc++;         }else if(nt == 'g'){             ng++;         }else if(nt == 't'){             nt++;         }else{             break;         }     }     printf(" %d %d %d %d", na, nc, ng, nt); } 

and when test code:

agcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagc 

it should give:

20 12 17 21 

but computer gives:

4200624 12 17 21 

i've put printf() functions find error located. i've seen in moment right before getting out of cicle na = 20, moment right after na = 4200624 . can do?

i believe due fact redeclaring variables in header, set variable 0. since declare na right after i, have created new variable same name, different scope. 1 visible in loop itself, destroyed after ends. other variables initialised due chain of assignments. i.e. initialised, not redeclared. initialising variables in same line have declared them, solve issue.


Comments

Popular posts from this blog

android - net_scheduler holding wakelock -

sql - MySQL : Getting Entries from a many-to-many table -

java - Retrieving data from database using jsp (Hibernate + Spring + Maven) -