for loop - C - error after for() cicle -


i've been coding in c solve problem in rosalind's website. code simple, , because it's simple, it's hard correct error.(i guess) here code:

    /* string ordered collection of symbols selected alphabet , formed word; length of string number of symbols contains.  example of length 21 dna string (whose alphabet contains symbols 'a', 'c', 'g', , 't') "atgcttcagaaaggtcttacg."  given: dna string s of length @ 1000 nt.  return: 4 integers (separated spaces) counting respective number of times symbols 'a', 'c', 'g', , 't' occur in s. */  #include <stdio.h>  int main(){     char nt;     int na, nc, ng, nt;     for(int = 0, na = nc = ng = nt = 0; < 1000; i++){         nt = getchar();         if(nt == 'a'){             na++;         }else if(nt == 'c'){             nc++;         }else if(nt == 'g'){             ng++;         }else if(nt == 't'){             nt++;         }else{             break;         }     }     printf(" %d %d %d %d", na, nc, ng, nt); }

and when test code:

agcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagc

it should give:

20 12 17 21

but computer gives:

4200624 12 17 21

i've put printf() functions find error located. i've seen in moment right before getting out of cicle na = 20, moment right after na = 4200624 . can do?

i believe due fact redeclaring variables in header, set variable 0. since declare na right after i, have created new variable same name, different scope. 1 visible in loop itself, destroyed after ends. other variables initialised due chain of assignments. i.e. initialised, not redeclared. initialising variables in same line have declared them, solve issue.


Comments

Post a Comment

Popular posts from this blog

javascript - jQuery: Add class depending on URL in the best way -

i have html progress meter: <div class="col-md-3" style="margin-left: -20px;"> <div class="progress-pos active" id="progess-1"> <div class="progress-pos-inner"> login </div> </div> </div> <div class="col-md-3 progress-pos-container"> <div class="progress-pos" id="progess-2"> <div class="progress-pos-inner"> scan items </div> </div> </div> <div class="col-md-3 progress-pos-container"> <div class="progress-pos" id="progess-3"> <div class="progress-pos-inner"> confirm address </div> </div> </div> <div class="col-md-3 progress-pos-container"> <div class="progress-pos" id="progess-4"> <div class="progress-pos-in...
Read more

caching - How to check if a url path exists in the service worker cache -

i need check if particular url path exists in service worker cache. example, suppose url is: /myserviceworker/service?a=110&b=70 this url exists in cache, there many of them different values of , b. now, suppose want refresh of these urls, how can that? i want know how access key values service worker cache. if know key, plan follows: var url = new url(key); if(url.pathname === "\/myserviceworker/service") refetch key but not sure how cache key , in format is. mean, string or url? cache api has match() method returns promise resolving in response object if match or undefined if no match exists. second parameter object can specify ignoresearch not take account url parameters. the ignoresearch option supported firefox ( chrome status here ). in other hand, retrieve cache entries, can use keys() method.
Read more

Redirect to a HTTPS version using .htaccess -

i need modify .htaccess file redirect urls https version without "www". http://example.com --> https://example.com http://www.example.com --> https://example.com https://www.example.com --> https://example.com this how .htaccess file looks like: rewriteengine on rewritecond %{request_filename} !-d rewritecond %{request_filename} !-f rewriterule ^(.*)$ redirect.php?id=$1&page=$2 [qsa,l] what modifications need make .htaccess in order forward https without "www"? it depends on doing current code. looks file called redirect trying display php page seo friendly url. think might confusing people. anyway, need , force https without www, need 1 more rule above. also second rule needs two capture groups in rewriterule test string because wanting 2 different values using $1 , $2 references. rewriteengine on #rediect www non www and/or http https --- combinations. rewritecond %{http_host} !^example\.com [nc,or] rewritecond %{https} !^...
Read more